LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
(Plasmid #68345)

• Purpose: A Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Berthelsen et al Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024.

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 13400
• Vector type: Mammalian Expression, CRISPR ; Flp/Frt
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: puromycin
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: CAG
• Tag / Fusion Protein:
  • linked to red flouresent protein gene mKateII (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: ClaI (unknown if destroyed)
• 5′ sequencing primer: gacaaagagacctacgtcga
• 3′ sequencing primer: gctcgtagaaggggaggttg

Gene/Insert 2

• Gene/Insert name: hCas9
• Species: Synthetic
• Promoter: CAG
• Tag / Fusion Protein:
  • mVenus (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsisI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: AGTACAACTACAACAGCCAC
• 3′ sequencing primer: GGTGCTGGTGTACCTCTTCC

Resource Information

• Supplemental Documents:
  • TRE CAG mKATE2 stop_Venus CASP9 med PA_
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry