LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
(Plasmid
#68345)
-
PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expression
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 68345-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 68345-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAmp
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 13400
-
Vector typeMammalian Expression, CRISPR ; Flp/Frt
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namepuromycin
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter CAG
-
Tag
/ Fusion Protein
- linked to red flouresent protein gene mKateII (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer gacaaagagacctacgtcga
- 3′ sequencing primer gctcgtagaaggggaggttg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehCas9
-
SpeciesSynthetic
- Promoter CAG
-
Tag
/ Fusion Protein
- mVenus (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AsisI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AGTACAACTACAACAGCCAC
- 3′ sequencing primer GGTGCTGGTGTACCTCTTCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 68345-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 68345-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR was a gift from Jannik Elverløv-Jakobsen (Addgene plasmid # 68345 ; http://n2t.net/addgene:68345 ; RRID:Addgene_68345) -
For your References section:
The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Berthelsen MF, Riedel M, Cai H, Skaarup SH, Alstrup AKO, Dagnaes-Hansen F, Luo Y, Jensen UB, Hager H, Liu Y, Callesen H, Vendelbo MH, Jakobsen JE, Thomsen MK. Cancers (Basel). 2021 Jun 16;13(12). pii: cancers13123024. doi: 10.3390/cancers13123024. 10.3390/cancers13123024 PubMed 34208747
Map uploaded by the depositor.
