Skip to main content

pT3-Neo
(Plasmid #69123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69123 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pT3
  • Backbone size w/o insert (bp) 4222
  • Total vector size (bp) 5017
  • Vector type
    Mammalian Expression ; Sleeping Beauty transposon
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Neo (codon optimized for human)
  • Species
    H. sapiens (human)
  • Promoter U3MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACTAACCAATCAGTTCGCTTCTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT3-Neo was a gift from Martin Bonamino (Addgene plasmid # 69123 ; http://n2t.net/addgene:69123 ; RRID:Addgene_69123)
  • For your References section:

    An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells. Chicaybam L, Barcelos C, Peixoto B, Carneiro M, Limia CG, Redondo P, Lira C, Paraguassu-Braga F, Vasconcelos ZF, Barros L, Bonamino MH. Front Bioeng Biotechnol. 2017 Jan 23;4:99. doi: 10.3389/fbioe.2016.00099. eCollection 2016. 10.3389/fbioe.2016.00099 PubMed 28168187