-
Purpose(Empty Backbone) Sleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promoters
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT3
- Backbone size (bp) 4222
-
Vector typeMammalian Expression ; Sleeping Beauty transposon
- Promoter U3MSCV
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACTAACCAATCAGTTCGCTTCTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The EF1a-GFP cassette was isolated from the plasmid pRRLsin.PPTs.EF1a.GFPpre (Bonamino et al., 2004) (provided by Dr. Didier Trono, EPFL, Switzerland) after digestion with ClaI/BstBI and inserted in pT3-Neo previously digested with ClaI.
EGFP has additional 10 amino acids on the c-terminus of EGFP (SGLRSRLASS). Depositor states that these amino acids do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT3-Neo-EF1a-GFP was a gift from Martin Bonamino (Addgene plasmid # 69134 ; http://n2t.net/addgene:69134 ; RRID:Addgene_69134) -
For your References section:
An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells. Chicaybam L, Barcelos C, Peixoto B, Carneiro M, Limia CG, Redondo P, Lira C, Paraguassu-Braga F, Vasconcelos ZF, Barros L, Bonamino MH. Front Bioeng Biotechnol. 2017 Jan 23;4:99. doi: 10.3389/fbioe.2016.00099. eCollection 2016. 10.3389/fbioe.2016.00099 PubMed 28168187