This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p3A9cbetaTCR.20beta
(Plasmid #69592)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69592 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p3A9CbetaTCR
  • Backbone manufacturer
    Carbone Lab, Addgene plasmid 69600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCR beta VJ region from clone 1.1
  • Alt name
    T cell receptor beta chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    500
  • Entrez Gene
    Tcrb (a.k.a. TCRbeta, Tib)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GATCGATGCTGCTGCACAGACCTACT
  • 3′ sequencing primer GATCGATCAGCTCACCTAACACGAGGA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3A9cbetaTCR.20beta was a gift from Francis R. Carbone (Addgene plasmid # 69592 ; http://n2t.net/addgene:69592 ; RRID:Addgene_69592)
  • For your References section:

    Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Barnden MJ, Allison J, Heath WR, Carbone FR. Immunol Cell Biol. 1998 Feb;76(1):34-40. 10.1046/j.1440-1711.1998.00709.x PubMed 9553774