This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69590)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 69590 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Kaye, et al. J. Immunol. 1992; 148: 3342-53.
  • Total vector size (bp) 8600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    TCR alpha
  • Alt name
    T cell receptor alpha chain
  • Alt name
    TCR alpha chain cDNA from Clone 1.1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Tcra (a.k.a. Tcralpha)
  • Promoter H-2Kb

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BglII (destroyed during cloning)
  • 5′ sequencing primer pES4-Fwd GGATCCAGGAATGGACAAGATTCTG
  • 3′ sequencing primer pES4-Rev CAGATCTCAACTGGACCACAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pES4/4a was a gift from Francis R. Carbone (Addgene plasmid # 69590 ; ; RRID:Addgene_69590)
  • For your References section:

    Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Barnden MJ, Allison J, Heath WR, Carbone FR. Immunol Cell Biol. 1998 Feb;76(1):34-40. 10.1046/j.1440-1711.1998.00709.x PubMed 9553774