Skip to main content

pEGFP N1 Ub-CRT
(Plasmid #69619)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69619 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 69619-D50 50 μg of DNA in Tris buffer $495
DNA 69619-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP N1
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6160
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ubiquitina-Calreticulin (mature)
  • Alt name
    Ub-CRT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1428
  • Mutation
    Deletion of signal peptide of calreticulin at the N-terminus (17aa)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Ubiquitin (N terminal on insert)
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGGGGTACCCCCAGCTCGTCCTTGGCCTGGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP N1 Ub-CRT was a gift from Marta Hallak (Addgene plasmid # 69619 ; http://n2t.net/addgene:69619 ; RRID:Addgene_69619)
  • For your References section:

    Calreticulin and Arginylated Calreticulin Have Different Susceptibilities to Proteasomal Degradation. Goitea VE, Hallak ME. J Biol Chem. 2015 Jun 26;290(26):16403-14. doi: 10.1074/jbc.M114.626127. Epub 2015 May 12. 10.1074/jbc.M114.626127 PubMed 25969538