Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #135929)


Item Catalog # Description Quantity Price (USD)
Plasmid 135929 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pAF150.2 SmaI + PmeI digest
  • Backbone manufacturer
    Andrew Flies Wild Immunology Laboratory
  • Vector type
    Mammalian Expression ; Transposon
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    mCherry fused to TNFSF9
  • Alt name
  • Alt name
  • Species
    Tasmanian devil (Sarcophilus harrisii)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcctcagacagtggttcaaag
  • 3′ sequencing primer aggcacagtcgaggctgat
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

See bioRxiv preprint: Please see the following article for protocols on how to construct or use this vector: Flies, A. S., Darby, J. M., Murphy, P. R., Pinfold, T. L., Patchett, A. L. & Lennard, P. R. Generation and Testing of Fluorescent Adaptable Simple Theranostic (FAST) Proteins. Bio-protocol under review (2020)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF92 was a gift from Andrew S. Flies (Addgene plasmid # 135929 ; ; RRID:Addgene_135929)
  • For your References section:

    A novel system to map protein interactions reveals evolutionarily conserved immune evasion pathways on transmissible cancers. Flies A, Darby JM, Lennard PR, Murphy PR, Ong CB, Pinfold TL, Lyons AB, Woods GM, Patchett AL. Science Advances 10.1126/sciadv.aba5031