Sema7a-AP-His
(Plasmid
#72049)
-
PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMVi-SV40ori
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSema7a
-
Alt nameSemaphorin 7A
-
Alt nameNCBI gene ID 20361; Reference sequence NM_011352.2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1929
-
Entrez GeneSema7a (a.k.a. 2900057C09Rik, CDw108, H-Sema K1, H-Sema-L, M-Sema-L, Semal, sema K1, sema L)
- Promoter CMV
-
Tag
/ Fusion Protein
- AP-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GTCAGAGGTAACTCCCGTTGC
- 3′ sequencing primer GAGGTTCTTGGCGGCTGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sema7a-AP-His was a gift from Woj Wojtowicz (Addgene plasmid # 72049 ; http://n2t.net/addgene:72049 ; RRID:Addgene_72049) -
For your References section:
An extracellular biochemical screen reveals that FLRTs and Unc5s mediate neuronal subtype recognition in the retina. Visser JJ, Cheng Y, Perry SC, Chastain AB, Parsa B, Masri SS, Ray TA, Kay JN, Wojtowicz WM. Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149. 10.7554/eLife.08149 PubMed 26633812