Skip to main content
Addgene
Open Menu

pCas9-polyA
(Plasmid #72602)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72602 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 72602-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 72602-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.3-TOPO

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-polyadenine
  • Alt name
    Cas9-polyA
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    2508
  • GenBank ID
  • Promoter T7
  • Tag / Fusion Protein
    • 81-bp polyadenylation

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTCCCCTT CTCCCTCTCC A
  • 3′ sequencing primer CCCATATGTCCTTCCGAGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9-polyA was a gift from Tomoji Mashimo (Addgene plasmid # 72602 ; http://n2t.net/addgene:72602 ; RRID:Addgene_72602)

  • For your References section:

    ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Yoshimi K, Kunihiro Y, Kaneko T, Nagahora H, Voigt B, Mashimo T. Nat Commun. 2016 Jan 20;7:10431. doi: 10.1038/ncomms10431. 10.1038/ncomms10431 PubMed 26786405
Related items:
Commonly requested with: