Skip to main content

hPlekhm1-C/pIRES puro Glue (S778-A1056)
(Plasmid #73456)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73456 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 73456-D50 50 μg of DNA in Tris buffer $495
DNA 73456-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRES puro Glue vector
  • Backbone manufacturer
    Addgene, vector number 15100
  • Backbone size w/o insert (bp) 5481
  • Total vector size (bp) 6315
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Plekhm1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    834
  • Entrez Gene
    PLEKHM1 (a.k.a. AP162, B2, OPTA3, OPTB6)
  • Tags / Fusion Proteins
    • strep tag (N terminal on backbone)
    • HA tag (N terminal on backbone)
    • CBP tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer TGGCGAGAACCTGTACTTCCAG
  • 3′ sequencing primer CAAGTGTATGGCCAGATCTCAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hPlekhm1-C/pIRES puro Glue (S778-A1056) was a gift from Paul Odgren (Addgene plasmid # 73456 ; http://n2t.net/addgene:73456 ; RRID:Addgene_73456)
  • For your References section:

    TRAFD1 (FLN29) Interacts with Plekhm1 and Regulates Osteoclast Acidification and Resorption. Witwicka H, Jia H, Kutikov A, Reyes-Gutierrez P, Li X, Odgren PR. PLoS One. 2015 May 19;10(5):e0127537. doi: 10.1371/journal.pone.0127537. eCollection 2015. 10.1371/journal.pone.0127537 PubMed 25992615