Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX458-sgRNA_Ago1_2
(Plasmid #73534)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73534 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Backbone size w/o insert (bp) 9300
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AGO1
  • gRNA/shRNA sequence
    GGATGGGGGGCCCATTTTGA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TTTATGGCGAGGCGGCGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-sgRNA_Ago1_2 was a gift from Constance Ciaudo (Addgene plasmid # 73534 ; http://n2t.net/addgene:73534 ; RRID:Addgene_73534)
  • For your References section:

    Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Ngondo RP, Cirera-Salinas D, Yu J, Wischnewski H, Bodak M, Vandormael-Pournin S, Geiselmann A, Wettstein R, Luitz J, Cohen-Tannoudji M, Ciaudo C. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023. 10.1016/j.stemcr.2017.12.023 PubMed 29396181