CAG-Crx-IRES-GFPd2
(Plasmid
#73997)
-
PurposePlasmid expressing Crx-IRES- GFPd2
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73997-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73997-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCAG-GFPd2
-
Backbone manufacturerAddgene (Plasmid #14760)
- Backbone size w/o insert (bp) 4763
- Total vector size (bp) 7125
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCrx-IRES-GFPd2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2362
-
Entrez GeneCrx (a.k.a. Crx1)
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gttcggcttctggcgtgt
- 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73997-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73997-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-Crx-IRES-GFPd2 was a gift from Connie Cepko (Addgene plasmid # 73997 ; http://n2t.net/addgene:73997 ; RRID:Addgene_73997) -
For your References section:
A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Wang S, Sengel C, Emerson MM, Cepko CL. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. 10.1016/j.devcel.2014.07.018 PubMed 25155555