-
PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-PuroR (v2); cloning backbone for sgRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePX462
- Backbone size w/o insert (bp) 4246
- Total vector size (bp) 10152
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (v2)
-
Alt namedCas9-DNMT3A-PuroR (ANV)
-
Alt nameSpdCas9-DNMT3A-T2A-PuroR (ANV)
-
Alt namedCas9-DNMT3A (ANV)
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)5906
-
MutationD10A and H840A in S.pyogenes Cas9; E756A inactivating mutation in H. sapiens DNMT3A
-
GenBank IDAKA60242.1 NP_072046.2
-
Entrez GeneDNMT3A (a.k.a. DNMT3A-3, DNMT3A2, HESJAS, M.HsaIIIA, TBRS)
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- T2A-PuroR (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer GS-linker For 5' GAAGAGGTACACCAGCACCAAAG 3'
- 3′ sequencing primer BGH Rev
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid is derived from Addgene plasmids #35521 and #48141.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence. The DNMT3A active site motif ENV was mutated to ANV (E756A).
Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase.
Puromycin gene was mutated by site-directed mutagenesis (H166R) to improve its efficacy.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdCas9-DNMT3A-PuroR (ANV)_v2 was a gift from Vlatka Zoldos (Addgene plasmid # 74408 ; http://n2t.net/addgene:74408 ; RRID:Addgene_74408) -
For your References section:
Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Vojta A, Dobrinic P, Tadic V, Bockor L, Korac P, Julg B, Klasic M, Zoldos V. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. 10.1093/nar/gkw159 PubMed 26969735