This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71667)


Item Catalog # Description Quantity Price (USD)
Plasmid 71667 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4246
  • Total vector size (bp) 10152
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    S. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR
  • Alt name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human), Synthetic; S. pyogenes
  • Insert Size (bp)
  • Mutation
    D10A and H840A in S.pyogenes Cas9
  • GenBank ID
    AKA60242.1 NP_072046.2
  • Entrez Gene
    DNMT3A (a.k.a. DNMT3A2, M.HsaIIIA, TBRS)
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • T2A-PuroR (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer GS-linker For 5' GAAGAGGTACACCAGCACCAAAG 3'
  • 3′ sequencing primer BGH Rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The catalytic domain of human DNMT3A (amino acids P602-V912) was derived from the plasmid pcDNA3/Myc-DNMT3A (Addgene, plasmid #35521) (Chen et al., 2005, J Cell Biochem 95: 902-917). Undesired BbsI restriction site was removed by site-directed mutagenesis, without affecting the amino acid sequence.
Plasmid pSpCas9n(BB)-2A-Puro (PX462) (Addgene, plasmid #48141) (Ran et al., 2013, Nat Protoc 8: 2281-2308) was used as a backbone. Additional H840A mutation was introduced into Cas9n D10A nickase.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pdCas9-DNMT3A-PuroR was a gift from Vlatka Zoldoš (Addgene plasmid # 71667)
  • For your References section:

    Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Vojta A, Dobrinic P, Tadic V, Bockor L, Korac P, Julg B, Klasic M, Zoldos V. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. 10.1093/nar/gkw159 PubMed 26969735