Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
(Plasmid
#75244)
-
PurposeCRISPR/Cas9 plasmid against human Helios
-
Depositing Lab
-
Depositing OrganizationDeutsches Rheuma-Forschungszentrum Berlin (DRFZ)
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 75244-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 75244-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX458-pSpCas9(BB)2A-GFP
-
Backbone manufacturerFeng Zhang (Plasmid #48138)
- Backbone size w/o insert (bp) 9703
- Total vector size (bp) 9703
-
Modifications to backboneCBH promoter exchanged for hEF1a promoter
-
Vector typeCRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA against human Helios
-
Alt nameIKZF2
-
gRNA/shRNA sequence(gg)CATATTGGAGTGCTCCCTTT
-
SpeciesH. sapiens (human)
-
GenBank ID22807 (Gene-ID)
-
Entrez GeneIKZF2 (a.k.a. ANF1A2, HELIOS, ICHAD, IMDIA, ZNF1A2, ZNFN1A2)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA contains at least 3 missmatches against human DNA (http://crispr.mit.edu) 2 additional nonmatching Guanidines added at 5' to enhance specificity (Kim, D. et al. Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat. Methods 12, 237–43, 1 p following 243 (2015).)
targets all isoforms.
DNA (Catalog # 75244-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 75244-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP) was a gift from Ria Baumgrass (Addgene plasmid # 75244 ; http://n2t.net/addgene:75244 ; RRID:Addgene_75244) -
For your References section:
Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. 10.1074/jbc.M116.739326 PubMed 27637333