Skip to main content

pYFP-RPB1aAmr
(Plasmid #75284)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75284 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 75284-D50 50 μg of DNA in Tris buffer $495
DNA 75284-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEYFP-C1
  • Backbone manufacturer
    BD Biosciences Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 10646
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    POLR2A
  • Alt name
    RPB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5911
  • Mutation
    N792D alpha-amanitin–resistant
  • GenBank ID
    NM_000937.4
  • Entrez Gene
    POLR2A (a.k.a. NEDHIB, POLR2, POLRA, RPB1, RPBh1, RPO2, RPOL2, RpIILS, hRPB220, hsRPB1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EYFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer pX-C1 REVseq TATGTTTCAGGTTCAGGGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYFP-RPB1aAmr was a gift from Xavier Darzacq & Robert Singer (Addgene plasmid # 75284 ; http://n2t.net/addgene:75284 ; RRID:Addgene_75284)
  • For your References section:

    In vivo dynamics of RNA polymerase II transcription. Darzacq X, Shav-Tal Y, de Turris V, Brody Y, Shenoy SM, Phair RD, Singer RH. Nat Struct Mol Biol. 2007 Sep;14(9):796-806. Epub 2007 Aug 5. 10.1038/nsmb1280 PubMed 17676063