This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

BRAF gRNA (BRDN0001145345)
(Plasmid #76479)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 76479 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 76479-LV Virus (1mL at titer ≥ 1x10⁶ TU/mL)
and Plasmid. More Information
$250
Concentrated Lentiviral Prep 76479-LVC Virus (50µL at titer ≥ 1×10⁸ TU/mL)
and Plasmid. More Information
$390

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Zhang Lab (Addgene plasmid # 52963)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BRAF
  • Alt name
    BRAF
  • Alt name
    NM_004333.4
  • gRNA/shRNA sequence
    ACAAATGATTAAGTTGACAC
  • Species
    H. sapiens (human)
  • Promoter hU6

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

The gRNA was designed to target the following Genbank reference sequence(s): NM_004333.4. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Information for Lentiviral Prep (Catalog # 76479-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from BRAF gRNA (BRDN0001145345) (#76479). In addition to the viral particles, you will also receive purified BRAF gRNA (BRDN0001145345) plasmid DNA.

Lentiviral particles carrying a BRAF gRNA (BRDN0001145345) and puromycin resistance.

Delivery

  • Volume 1mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 76479-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the hU6 and EF1-alpha promoters. The PCR product was visualized on an agarose gel for size confirmation, purified and the guide sequence was confirmed by Sanger sequencing.
    Forward Primer: hU6-F GAGGGCCTATTTCCCATGATT
    Reverse Primer: EF1a-R CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

Information for Concentrated Lentiviral Prep (Catalog # 76479-LVC) ( Back to top )

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from BRAF gRNA (BRDN0001145345) (#76479). In addition to the viral particles, you will also receive purified BRAF gRNA (BRDN0001145345) plasmid DNA.

Concentrated lentiviral particles carrying a BRAF gRNA (BRDN0001145345) and puromycin resistance.

Delivery

  • Volume 50 µL
  • Titer ≥1×10⁸ TU/mL
  • Pricing $360 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker Puromycin
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 76479-LVC and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BRAF gRNA (BRDN0001145345) was a gift from John Doench & David Root (Addgene plasmid # 76479)
  • For your References section:

    Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437. 10.1038/nbt.3437 PubMed 26780180