Skip to main content

pGCaMP5-DHFR
(Plasmid #78706)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78706 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 78706-D50 50 μg of DNA in Tris buffer $495
DNA 78706-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    N/A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    GCaMP5
  • Species
    Synthetic
  • Insert Size (bp)
    1353
  • Promoter Toxoplasma SAG1 5' UTR

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer taatacgactcactatagggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DHFR
  • Species
    Toxoplasma gondii
  • Insert Size (bp)
    3051

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGCaMP5-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 78706 ; http://n2t.net/addgene:78706 ; RRID:Addgene_78706)
  • For your References section:

    Using a Genetically Encoded Sensor to Identify Inhibitors of Toxoplasma gondii Ca2+ Signaling. Sidik SM, Hortua Triana MA, Paul AS, El Bakkouri M, Hackett CG, Tran F, Westwood NJ, Hui R, Zuercher WJ, Duraisingh MT, Moreno SN, Lourido S. J Biol Chem. 2016 Apr 29;291(18):9566-80. doi: 10.1074/jbc.M115.703546. Epub 2016 Mar 1. 10.1074/jbc.M115.703546 PubMed 26933036