Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pU6-Universal
(Plasmid #52694)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52694 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 2736
  • Total vector size (bp) 8371
  • Vector type
    CRISPR ; Toxoplasma gondii

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    dam-/dcm- (NEB catalog # C2925I)
  • Growth instructions
    This plasmid grows fine in DH5a, but BsaI digestion is methylation-sensitive, so growth in a Dcm- strain is necessary prior to inserting a protospacer.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Synthetic; Originally from Streptococcus progenies, codon-optimized for Plasmodium falciparum
  • Insert Size (bp)
    4270
  • Promoter TgTUB1
  • Tags / Fusion Proteins
    • 3X FLAG (N terminal on insert)
    • Nuclear localization signal (N terminal on insert)
    • Nuclear localization signal (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Toxoplasma U6 upstream region - protospacer cloning sequence - chiRNA
  • Species
    Synthetic; Toxoplasma gondii, streptococcus pyogenes
  • Insert Size (bp)
    605
  • Promoter Toxoplasma U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PciI (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cacctctgacttgagcgtcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Tim Wang
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Cong L, Ran FA, Cox D, Lin S, Barretto R, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339: 819–823. doi:10.1126/science.1231143.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-Universal was a gift from Sebastian Lourido (Addgene plasmid # 52694 ; http://n2t.net/addgene:52694 ; RRID:Addgene_52694)