Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pU6-DHFR
(Plasmid #80329)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80329 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pU6-Universal
  • Backbone size w/o insert (bp) 8380
  • Total vector size (bp) 6284
  • Modifications to backbone
    Replaced Cas9 with DHFR-TSc3
  • Vector type
    CRISPR
  • Selectable markers
    DHFR-TSc3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    dam-/dcm- competent E coli (NEB Catalog# C2925)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DHFR-TSc3
  • Species
    Toxoplasma gondii
  • Insert Size (bp)
    3057
  • Promoter DHFR-TS 5' UTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer ctagcatgtcattcgattttcacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 80329 ; http://n2t.net/addgene:80329 ; RRID:Addgene_80329)
  • For your References section:

    A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426