pU6-DHFR
(Plasmid #80329)

• Purpose: Allows for expression of an sgRNA in Toxoplasma gondii and confers resistance to pyrimethamine
• Depositing Lab: Sebastian Lourido
• Publication: Sidik et al Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2.

Backbone

• Vector backbone: pU6-Universal
• Backbone size w/o insert (bp): 8380
• Total vector size (bp): 6284
• Modifications to backbone: Replaced Cas9 with DHFR-TSc3
• Vector type: CRISPR
• Selectable markers: DHFR-TSc3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): dam-/dcm- competent E coli (NEB Catalog# C2925)
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: DHFR-TSc3
• Species: Toxoplasma gondii
• Insert Size (bp): 3057
• Promoter: DHFR-TS 5' UTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: ctagcatgtcattcgattttcacc

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry