-
Purpose(Empty Backbone) For CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAs
-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHDE
-
Backbone manufacturerZhao Lab
- Backbone size (bp) 8000
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin ; mCherry fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTGGTTGGCATGCACATAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHDE-35S-Cas9-mCherry-UBQ was a gift from Yunde Zhao (Addgene plasmid # 78932 ; http://n2t.net/addgene:78932 ; RRID:Addgene_78932) -
For your References section:
An effective strategy for reliably isolating heritable and Cas9-free Arabidopsis mutants generated by CRISPR/Cas9-mediated genome editing. Gao X, Chen J, Dai X, Zhang D, Zhao Y. Plant Physiol. 2016 May 15. pii: pp.00663.2016. 10.1104/pp.16.00663 PubMed 27208253