-
PurposeGenetically encoded melanosome-localized pH sensor.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80151 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCR3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5537
- Total vector size (bp) 8861
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOCA2
-
Alt nameP Protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2517
-
Mutationnonpathologic polymorphism D257A, pore mutation V443I
-
GenBank IDNM_000275
-
Entrez GeneOCA2 (a.k.a. BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNectarine in first luminal loop
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CACCTTCCAGGGTCAAGGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was derived from pCR3/OCA2-HA (Sitaram A, et al. (2009) Localization to mature melanosomes by virtue of cytoplasmic dileucine motifs is required for human OCA2 function. Mol Biol Cell 20(5):1464–1477)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MELOPS was a gift from Santiago Di Pietro (Addgene plasmid # 80151 ; http://n2t.net/addgene:80151 ; RRID:Addgene_80151) -
For your References section:
TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606
Map uploaded by the depositor.