MELOPS
(Plasmid #80151)

• Purpose: Genetically encoded melanosome-localized pH sensor.
• Depositing Lab: Santiago Di Pietro
• Publication: Ambrosio et al Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2.

Backbone

• Vector backbone: pCR3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5537
• Total vector size (bp): 8861
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: OCA2
• Alt name: P Protein
• Species: H. sapiens (human)
• Insert Size (bp): 2517
• Mutation: nonpathologic polymorphism D257A, pore mutation V443I
• GenBank ID: NM_000275
• Entrez Gene: OCA2 (a.k.a. BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mNectarine in first luminal loop

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CACCTTCCAGGGTCAAGGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This plasmid was derived from pCR3/OCA2-HA (Sitaram A, et al. (2009) Localization to mature melanosomes by virtue of cytoplasmic dileucine motifs is required for human OCA2 function. Mol Biol Cell 20(5):1464–1477)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA