piRFP-N3-Tyrosinase
(Plasmid #80152)

• Purpose: Melanosome marker
• Depositing Lab: Santiago Di Pietro
• Publication: Ambrosio et al Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2.

Backbone

• Vector backbone: piRFP682
• Backbone size w/o insert (bp): 4904
• Total vector size (bp): 6546
• Modifications to backbone: EGFP in pEGFP-N3 was replaced by iRFP682 to generate piRFP682-N3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tyrosinase
• Species: H. sapiens (human)
• Insert Size (bp): 1642
• GenBank ID: NM_000372
• Entrez Gene: TYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
• Promoter: CMV
• Tag / Fusion Protein:
  • iRFP682 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTCTACAAATGTGGTATGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA