Skip to main content
Addgene
Open Menu

piRFP-N3-Tyrosinase
(Plasmid #80152)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80152 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 80152-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 80152-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    piRFP682
  • Backbone size w/o insert (bp) 4904
  • Total vector size (bp) 6546
  • Modifications to backbone
    EGFP in pEGFP-N3 was replaced by iRFP682 to generate piRFP682-N3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tyrosinase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1642
  • GenBank ID
    NM_000372
  • Entrez Gene
    TYR (a.k.a. ATN, CMM8, OCA1, OCA1A, OCAIA, SHEP3)
  • Promoter CMV
  • Tag / Fusion Protein
    • iRFP682 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piRFP-N3-Tyrosinase was a gift from Santiago Di Pietro (Addgene plasmid # 80152 ; http://n2t.net/addgene:80152 ; RRID:Addgene_80152)

  • For your References section:

    TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606
Related items:
Commonly requested with: