Skip to main content

pGCaMP6m-N3-TPC2
(Plasmid #80147)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80147 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 80147-D50 50 μg of DNA in Tris buffer $495
DNA 80147-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGCaMP6m-N3
  • Backbone size w/o insert (bp) 5353
  • Total vector size (bp) 7609
  • Modifications to backbone
    EGFP in pEGFP-N3 was replaced by GCaMP6m (BamHI-NotI) to generate pGCaMP6m-N3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TPCN2
  • Alt name
    TPC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2256
  • Entrez Gene
    TPCN2 (a.k.a. SHEP10, TPC2)
  • Promoter CMV
  • Tag / Fusion Protein
    • GCaMP6m (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCTACAAATGTGGTATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGCaMP6m-N3-TPC2 was a gift from Santiago Di Pietro (Addgene plasmid # 80147 ; http://n2t.net/addgene:80147 ; RRID:Addgene_80147)
  • For your References section:

    TPC2 mediates new mechanisms of platelet dense granule membrane dynamics through regulation of Ca2+ release. Ambrosio AL, Boyle JA, Di Pietro SM. Mol Biol Cell. 2015 Sep 15;26(18):3263-74. doi: 10.1091/mbc.E15-01-0058. Epub 2015 Jul 22. 10.1091/mbc.E15-01-0058 PubMed 26202466