pSKA397
(Plasmid #80380)

• Purpose: mini-Tn7 delivery plasmid with metE under the cpcG2Δ59 promoter.
• Depositing Lab: Mustafa Khammash
• Publication: Milias-Argeitis et al Nat Commun. 2016 Aug 26;7:12546. doi: 10.1038/ncomms12546.

Backbone

• Vector backbone: pUC18R6KT-mini-Tn7T (Addgene #64958)
• Backbone manufacturer: Choi KH et al. 2005. Nature Methods, 2(6): 443-448.
• Backbone size w/o insert (bp): 3485
• Total vector size (bp): 7261
• Vector type: Bacterial Expression, Synthetic Biology ; mini-Tn7 delivery vector

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): CC118 (λpir)
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: cat
• Alt name: chloramphenicol acetyltransferase
• Species: Tn9
• Insert Size (bp): 660
• Promoter: cat promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CGAAAAGTGCCACCTGAC
• 3′ sequencing primer: GATAGAGAAAAGCACAATGGGCT

Gene/Insert 2

• Gene/Insert name: metE
• Alt name: methionine synthase
• Species: E. coli
• Insert Size (bp): 2262
• GenBank ID: NC_000913.3
• Promoter: cpcG2Δ59

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAGTTATTGGTGCCCTTAAAC
• 3′ sequencing primer: CGCCCAAACATAACAGGAAG

Resource Information

• Supplemental Documents:
  • pSKA397 annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry