Skip to main content

pSc1
(Plasmid #80436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80436 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 80436-D50 50 μg of DNA in Tris buffer $495
DNA 80436-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5116
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sp Cas9 gRNA
  • Alt name
    Streptococcus pyogenes guideRNA
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    76
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCGCTTCCTCGTGCTTTAC
  • 3′ sequencing primer CACGTTAAGGGATTTTGGTCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eGFP
  • Alt name
    enhanced green fluorescent protein
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer AGCTGCAATAAACAAGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSc1 was a gift from Ervin Welker (Addgene plasmid # 80436 ; http://n2t.net/addgene:80436 ; RRID:Addgene_80436)
  • For your References section:

    A convenient method to pre-screen candidate guide RNAs for CRISPR/Cas9 gene editing by NHEJ-mediated integration of a 'self-cleaving' GFP-expression plasmid. Talas A, Kulcsar PI, Weinhardt N, Borsy A, Toth E, Szebenyi K, Krausz SL, Huszar K, Vida I, Sturm A, Gordos B, Hoffmann OI, Bencsura P, Nyeste A, Ligeti Z, Fodor E, Welker E. DNA Res. 2017 Jun 30. doi: 10.1093/dnares/dsx029. 10.1093/dnares/dsx029 PubMed 28679166