pSc2
(Plasmid
#80437)
-
PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80437 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5116
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesp Cas9 gRNA
-
Alt nameStreptococcus pyogenes guideRNA
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)76
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCGCTTCCTCGTGCTTTAC
- 3′ sequencing primer CACGTTAAGGGATTTTGGTCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Alt nameenhanced green fluorescent protein
-
Insert Size (bp)717
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer AGCTGCAATAAACAAGTT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSc2 was a gift from Ervin Welker (Addgene plasmid # 80437 ; http://n2t.net/addgene:80437 ; RRID:Addgene_80437) -
For your References section:
A convenient method to pre-screen candidate guide RNAs for CRISPR/Cas9 gene editing by NHEJ-mediated integration of a 'self-cleaving' GFP-expression plasmid. Talas A, Kulcsar PI, Weinhardt N, Borsy A, Toth E, Szebenyi K, Krausz SL, Huszar K, Vida I, Sturm A, Gordos B, Hoffmann OI, Bencsura P, Nyeste A, Ligeti Z, Fodor E, Welker E. DNA Res. 2017 Jun 30. doi: 10.1093/dnares/dsx029. 10.1093/dnares/dsx029 PubMed 28679166