Skip to main content
Addgene
Open Menu

pmCherry_gRNA
(Plasmid #80457)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80457 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 80457-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 80457-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 2871
  • Total vector size (bp) 5033
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sp Cas9 gRNA
  • Alt name
    Streptococcus pyogenes guideRNA
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    76
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CCTCTGACTTGAGCGTCG
  • 3′ sequencing primer AGTAGGAAAGTCCCGTAAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    717
  • Promoter chicken β-actin promoter

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer aagggatggttggttggtgg
  • 3′ sequencing primer CCTTTCTCGCCACGTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry_gRNA was a gift from Ervin Welker (Addgene plasmid # 80457 ; http://n2t.net/addgene:80457 ; RRID:Addgene_80457)

  • For your References section:

    Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763
Related items:
Commonly requested with: