Skip to main content

pCas5
(Plasmid #82378)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82378 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 82378-D50 50 μg of DNA in Tris buffer $495
DNA 82378-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 5538

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA
  • gRNA/shRNA sequence
    YFP
  • Promoter PJ23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTGGGTAACGCCAGGGT
  • 3′ sequencing primer GCTTCCGGCTCGTATGTTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas5 was a gift from Brian Pfleger (Addgene plasmid # 82378 ; http://n2t.net/addgene:82378 ; RRID:Addgene_82378)
  • For your References section:

    CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Gordon GC, Korosh TC, Cameron JC, Markley AL, Begemann MB, Pfleger BF. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. 10.1016/j.ymben.2016.07.007 PubMed 27481676