pBAD24-BamA-T558TAG
(Plasmid #83116)

• Purpose: protein expression of BamA T558TAG mutant
• Depositing Labs: Johan Elf, Kalle Kipper
• Depositing Organization: Uppsala University
  Located in Sweden
• Publication: Elf lab plasmids (unpublished)

Backbone

• Vector backbone: pBAD24
• Backbone size w/o insert (bp): 4542
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BamA
• Species: E. coli
• Insert Size (bp): 2433
• Mutation: T558TAG (Please see depositor comment below)
• Promoter: araBAD

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGCACGGCGTCACACTTTGC
• 3′ sequencing primer: TCTGAGTTCGGCATGGGGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A premature TAG stop codon has been intentionally introduced into the protein coding sequences in this construct. This construct was used to site-specifically incorporate noncanonical amino acids (NcAA) at the introduced TAG codon using the Methanosarcina mazei pyrrolysyl-tRNA/pyrrolysyl-tRNA synthetase (=tRNA-Pyl/PylRS) pair. The NcAA is incorporated into the plasmid-encoded protein at the introduced TAG codon in the presence of the tRNA-pyl/PylRS pair and 1 mM NcAA in the expression medium.

So to express a full-length protein, the expression host must additionally harbor a plasmid encoding the tRNA-Pyl/PylRS pair. This plasmid is called pEVOL and has been created by Peter Schultz and coworkers (Young, T. S., Ahmad, I., Yin, J. A., and Schultz, P. G. (2010) An enhanced system for unnatural amino acid mutagenesis in E.coli, J. Mol. Biol. 395, 361 - 374) and further modified by Edward Lemke and coworkers (Plass, T., Milles, S., Koehler, C., Schultz, C., and Lemke, E. A. (2011) Genetically encoded copper-free click chemistry, Angew. Chem. Int. Ed. 50, 3878 - 3881).