pBAD24-EF-Tu-D182TAG
(Plasmid
#83117)
-
Purposeprotein expression of EF-Tu-D182TAG mutant
-
Depositing Labs
-
Depositing OrganizationUppsala University
Located in Sweden -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBAD24
- Backbone size w/o insert (bp) 4542
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF-Tu
-
SpeciesE. coli
-
Insert Size (bp)1202
-
MutationD182TAG (please see depositor comment below)
- Promoter araBAD
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TGCACGGCGTCACACTTTGC
- 3′ sequencing primer TCTGAGTTCGGCATGGGGTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A premature TAG stop codon has been intentionally introduced into the protein coding sequences in this construct. This construct was used to site-specifically incorporate noncanonical amino acids (NcAA) at the introduced TAG codon using the Methanosarcina mazei pyrrolysyl-tRNA/pyrrolysyl-tRNA synthetase (=tRNA-Pyl/PylRS) pair. The NcAA is incorporated into the plasmid-encoded protein at the introduced TAG codon in the presence of the tRNA-pyl/PylRS pair and 1 mM NcAA in the expression medium.
So to express a full-length protein, the expression host must additionally harbor a plasmid encoding the tRNA-Pyl/PylRS pair. This plasmid is called pEVOL and has been created by Peter Schultz and coworkers (Young, T. S., Ahmad, I., Yin, J. A., and Schultz, P. G. (2010) An enhanced system for unnatural amino acid mutagenesis in E.coli, J. Mol. Biol. 395, 361 - 374) and further modified by Edward Lemke and coworkers (Plass, T., Milles, S., Koehler, C., Schultz, C., and Lemke, E. A. (2011) Genetically encoded copper-free click chemistry, Angew. Chem. Int. Ed. 50, 3878 - 3881).
Expression of PylRS from the pEVOL plasmid is induced with L-arabinose (0.02 % L-arabinose concentration works fine), tRNA-pyl is expressed from a constitutive promoter. When expressed under the above mentioned conditions, proteins from Addgene constructs 83117, 83118, 83119 contain a C-terminal His6 purification tag.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD24-EF-Tu-D182TAG was a gift from Johan Elf & Kalle Kipper (Addgene plasmid # 83117)