Skip to main content
Addgene
Open Menu

pBAD24-LacI-A312TAG
(Plasmid #83122)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83122 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD24
  • Backbone size w/o insert (bp) 4542
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacI
  • Species
    E. coli
  • Insert Size (bp)
    1082
  • Mutation
    A312TAG (Please see depositor comment below)
  • Promoter araBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TGCACGGCGTCACACTTTGC
  • 3′ sequencing primer TCTGAGTTCGGCATGGGGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A premature TAG stop codon has been intentionally introduced into the protein coding sequences in this construct. This construct was used to site-specifically incorporate noncanonical amino acids (NcAA) at the introduced TAG codon using the Methanosarcina mazei pyrrolysyl-tRNA/pyrrolysyl-tRNA synthetase (=tRNA-Pyl/PylRS) pair. The NcAA is incorporated into the plasmid-encoded protein at the introduced TAG codon in the presence of the tRNA-pyl/PylRS pair and 1 mM NcAA in the expression medium.

So to express a full-length protein, the expression host must additionally harbor a plasmid encoding the tRNA-Pyl/PylRS pair. This plasmid is called pEVOL and has been created by Peter Schultz and coworkers (Young, T. S., Ahmad, I., Yin, J. A., and Schultz, P. G. (2010) An enhanced system for unnatural amino acid mutagenesis in E.coli, J. Mol. Biol. 395, 361 - 374) and further modified by Edward Lemke and coworkers (Plass, T., Milles, S., Koehler, C., Schultz, C., and Lemke, E. A. (2011) Genetically encoded copper-free click chemistry, Angew. Chem. Int. Ed. 50, 3878 - 3881).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD24-LacI-A312TAG was a gift from Johan Elf & Kalle Kipper (Addgene plasmid # 83122)
Related items: