Skip to main content

pSELECT-HA-mFOXO1-D256
(Plasmid #83379)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83379 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 83379-D50 50 μg of DNA in Tris buffer $495
DNA 83379-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSELECT-puro
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 3390
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Forkhead box O1
  • Alt name
    FoxO1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    768
  • Mutation
    N256TAG (premature stop codon)
  • GenBank ID
    NM_019739.3
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter EF-1a
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GACCCTGCTTGCTCAACTCT
  • 3′ sequencing primer GAGCTCAGCCGAGAAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FOXO1-D256 was cloned from Myc-FOXO1 D256 containing dominant-negative mouse FOXO1 truncation mutant ORF fused to myc-tag was obtained from AddGene (plasmid 12145) originally constructed by Nakae and coworkers (EMBO J 19:989, 2000)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSELECT-HA-mFOXO1-D256 was a gift from Steven Abcouwer (Addgene plasmid # 83379 ; http://n2t.net/addgene:83379 ; RRID:Addgene_83379)