-
PurposeExpresses TET1 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationTemple University Health Sciences Center
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 83568-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 83568-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES-hrGFPII
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 11908
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsWe are successful if we use Stbl3 bacteria for transformation coupled with extended growth periods at 37 degrees.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet Methylcytosine Dioxygenase 1
-
Alt nameTET1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6408
-
GenBank IDNM_030625
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3X FLAG tag (C terminal on backbone)
- hr GFP II (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer ATGCAGTCGTCGAGGAATTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: This plasmid contains an I1123M mutation in Tet1 compared to NM_030625 that the depositor has confirmed does not affect plasmid function.
DNA (Catalog # 83568-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 83568-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES-hrGFP II-TET1 was a gift from Jean-Pierre Issa (Addgene plasmid # 83568 ; http://n2t.net/addgene:83568 ; RRID:Addgene_83568) -
For your References section:
TET1 is a maintenance DNA demethylase that prevents methylation spreading in differentiated cells. Jin C, Lu Y, Jelinek J, Liang S, Estecio MR, Barton MC, Issa JP. Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29. 10.1093/nar/gku372 PubMed 24875481