Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIRES-hrGFP II-mTET1
(Plasmid #83569)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83569 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRES-hrGFPII
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 11908
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 bacteria should be used for transformation and plasmid should be grown at 37 for extended periods.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet Methylcytosine Dioxygenase 1
  • Alt name
    TET1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6408
  • Mutation
    catalytic domain mutant H1672D, D1674A
  • GenBank ID
    NM_030625
  • Entrez Gene
    TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3X FLAG tag (C terminal on backbone)
    • hr GFP II (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer ATGCAGTCGTCGAGGAATTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutation location described in the following publication: Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells, EPIGENETICS 2015

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES-hrGFP II-mTET1 was a gift from Jean-Pierre Issa (Addgene plasmid # 83569 ; http://n2t.net/addgene:83569 ; RRID:Addgene_83569)
  • For your References section:

    TET1 is a maintenance DNA demethylase that prevents methylation spreading in differentiated cells. Jin C, Lu Y, Jelinek J, Liang S, Estecio MR, Barton MC, Issa JP. Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29. 10.1093/nar/gku372 PubMed 24875481