pIRES-hrGFP II-mTET1_CD
(Plasmid
#83571)
-
PurposeExpresses a mutant catalytic domain of TET1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIRES-hrGFPII
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 7654
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTet Methylcytosine Dioxygenase 1
-
Alt nameTET1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2154
-
MutationTET1 amino acids 1-1417 deleted, catalytic domain mutations H1672Y, D1674A
-
GenBank IDNM_030625
-
Entrez GeneTET1 (a.k.a. CXXC6, LCX, bA119F7.1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3X FLAG tag (C terminal on backbone)
- hr GFP II (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer ATGCAGTCGTCGAGGAATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation location described in the following publication: Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells, EPIGENETICS 2015
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRES-hrGFP II-mTET1_CD was a gift from Jean-Pierre Issa (Addgene plasmid # 83571 ; http://n2t.net/addgene:83571 ; RRID:Addgene_83571) -
For your References section:
TET1 is a maintenance DNA demethylase that prevents methylation spreading in differentiated cells. Jin C, Lu Y, Jelinek J, Liang S, Estecio MR, Barton MC, Issa JP. Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29. 10.1093/nar/gku372 PubMed 24875481