pIRES-hrGFP II-mTET1_CD
(Plasmid #83571)

• Purpose: Expresses a mutant catalytic domain of TET1 in mammalian cells
• Depositing Lab: Jean-Pierre Issa
• Depositing Organization: Temple University Health Sciences Center
  Located in United States of America
• Publication: Jin et al Nucleic Acids Res. 2014 Jun;42(11):6956-71. doi: 10.1093/nar/gku372. Epub 2014 May 29.

Backbone

• Vector backbone: pIRES-hrGFPII
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 7654
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tet Methylcytosine Dioxygenase 1
• Alt name: TET1
• Species: H. sapiens (human)
• Insert Size (bp): 2154
• Mutation: TET1 amino acids 1-1417 deleted, catalytic domain mutations H1672Y, D1674A
• GenBank ID: NM_030625
• Entrez Gene: TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3X FLAG tag (C terminal on backbone)
  • hr GFP II (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: ATGGGCGGTAGGCGTGTA
• 3′ sequencing primer: ATGCAGTCGTCGAGGAATTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutation location described in the following publication: Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells, EPIGENETICS 2015

DNA (Catalog # 83571-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 83571-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.