pCLHCX-mPM20D1-flag
(Plasmid #84566)

• Purpose: mouse PM20D1, C-term flag and his tags, in mammalian retroviral expression plasmid. Amp/Hygro selection
• Depositing Lab: Bruce Spiegelman
• Publication: Long et al Cell. 2016 Jul 14;166(2):424-35. doi: 10.1016/j.cell.2016.05.071. Epub 2016 Jun 30.

Backbone

• Vector backbone: pCLNCX
• Backbone manufacturer: Novus Bio
• Backbone size w/o insert (bp): 9400
• Total vector size (bp): 11000
• Modifications to backbone: Neo resistance changed to hygro, BamHI before second CMV is destroyed, between HindIII and XhoI is inserted [MluI, BglII, AgeI, BamHI, flag, NotI, 6xHis], WPRE inserted between XhoI and ClaI
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: peptidase M20 domain containing 1
• Alt name: PM20D1
• Species: M. musculus (mouse)
• Insert Size (bp): 1600
• GenBank ID: NM_178079.3
• Entrez Gene: Pm20d1 (a.k.a. 4732466D17Rik, AI098026)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Flag (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GAGCTCGTTTAGTGAACCGTC
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCCAC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry