Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #132684)


Item Catalog # Description Quantity Price (USD)
Plasmid 132684 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7100
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Peptidase M20 domain containing 2
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Pm20d2 (a.k.a. Acy1l2, Gm424)
  • Promoter Chicken b-actin
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer WPRE-R, CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENN.AAV.CB7.CI.PM20D2-flag.WPRE.rBG was a gift from Jonathan Long (Addgene plasmid # 132684 ; ; RRID:Addgene_132684)