pGem-nHyPer2:sHyper2
(Plasmid #84737)

• Purpose: Simultaneous expresion of nuclear and stromal HyPer2 in plant cells
• Depositing Lab: Philip Mullineaux
• Publication: Exposito-Rodriguez et al Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w.

Backbone

• Vector backbone: pGemini (Dr. Andrew Simkin)
• Backbone manufacturer: pGWB2
• Backbone size w/o insert (bp): 16636
• Total vector size (bp): 19435
• Modifications to backbone: bi-directional vector built in house where the expression of two transgenes is driven by back-to-back CaMV35s and Figwort Mosaic Virus (FMV) constitutive promoters.
• Vector type: Plant Expression
• Selectable markers: Hygromycin ; Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HyPer2 targeted to nucleus
• Insert Size (bp): 1479
• Promoter: pFMV/p35S
• Tags / Fusion Proteins:
  • NLS-SV40 (N terminal on insert)
  • NLS-SV40 (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry