Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGem-sHyper:sAPX
(Plasmid #84738)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84738 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGemini (Dr. Andrew Simkin)
  • Backbone manufacturer
    pGWB2
  • Backbone size w/o insert (bp) 16636
  • Total vector size (bp) 19435
  • Modifications to backbone
    bi-directional vector built in house where the expression of two transgenes is driven by back-to-back CaMV35s and Figwort Mosaic Virus (FMV) constitutive promoters.
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    sAPX
  • Alt name
    Arabidopsis stromal ascorbate peroxidase (At4g08390)
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    SAPX (a.k.a. AT4G08390, STROMAL ASCORBATE PEROXIDASE, T28D5.80, T28D5_80, stromal ascorbate peroxidase)
  • Promoter pFMV/p35S

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sHyper (HyPer2 targeted to nucleus)
  • Promoter pFMV/p35S
  • Tags / Fusion Proteins
    • nuclear localization signals from the coding sequence of Simian Virus 40 (SV40) (N terminal on insert)
    • nuclear localisation signals from the coding sequence of Simian Virus 40 (SV40) (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGem-sHyper:sAPX was a gift from Philip Mullineaux (Addgene plasmid # 84738 ; http://n2t.net/addgene:84738 ; RRID:Addgene_84738)
  • For your References section:

    Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Exposito-Rodriguez M, Laissue PP, Yvon-Durocher G, Smirnoff N, Mullineaux PM. Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w. 10.1038/s41467-017-00074-w [pii] PubMed 28663550