pEX-A-U6-TelgRNA_PuroR
(Plasmid
#84782)
-
PurposeExpresses telomere-specific sgRNA.
-
Depositing Lab
-
Depositing OrganizationLudwig-Maximilians-Universitaet Muenchen (LMU)
Located in Germany -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 84782-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 84782-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEX-A
- Backbone size w/o insert (bp) 5314
- Total vector size (bp) 5334
-
Vector typeMammalian Expression, Bacterial Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametelomere-specific sgRNA
-
gRNA/shRNA sequenceTAGGGTTAGGGTTAGGGTTA
- Promoter U6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5´- GAG GGC CTA TTT CCC ATG ATT C-3´
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 84782-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 84782-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEX-A-U6-TelgRNA_PuroR was a gift from Heinrich Leonhardt (Addgene plasmid # 84782 ; http://n2t.net/addgene:84782 ; RRID:Addgene_84782) -
For your References section:
Determination of Local Chromatin Composition by CasID. Schmidtmann E, Anton T, Rombaut P, Herzog F, Leonhardt H. Nucleus. 2016 Sep 27:0. 10.1080/19491034.2016.1239000 PubMed 27676121