Skip to main content
Addgene

sgAAVS1(B)
(Plasmid #85571)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85571 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459)
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 9200
  • Modifications to backbone
    Insertion of a sgRNA sequence targeting AAVS1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    adeno-associated virus integration site 1
  • gRNA/shRNA sequence
    GTCACCAATCCTGTCCCTAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    AAVS1 (a.k.a. AAV)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgAAVS1(B) was a gift from Luca Grumolato (Addgene plasmid # 85571 ; http://n2t.net/addgene:85571 ; RRID:Addgene_85571)

  • For your References section:

    CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Guernet A, Mungamuri SK, Cartier D, Sachidanandam R, Jayaprakash A, Adriouch S, Vezain M, Charbonnier F, Rohkin G, Coutant S, Yao S, Ainani H, Alexandre D, Tournier I, Boyer O, Aaronson SA, Anouar Y, Grumolato L. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. 10.1016/j.molcel.2016.06.017 PubMed 27453044
Related items:
Commonly requested with: