pKER-mKOk
(Plasmid
#85975)
-
PurposeExpresses mKOk from the EF1a promoter in mammalian cells
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85975-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85975-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepKER
-
Backbone manufacturerCalos Lab
- Total vector size (bp) 4111
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKOk
-
Insert Size (bp)657
- Promoter EF-1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgccgttacagatccaagctgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 85975-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85975-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKER-mKOk was a gift from Michele Calos (Addgene plasmid # 85975 ; http://n2t.net/addgene:85975 ; RRID:Addgene_85975) -
For your References section:
In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Geisinger JM, Turan S, Hernandez S, Spector LP, Calos MP. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542. 10.1093/nar/gkv1542 PubMed 26762978