Skip to main content

HUWE1-sgRNA-2
(Plasmid #86925)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86925 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 86925-D50 50 μg of DNA in Tris buffer $495
DNA 86925-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9(D10A)
  • Modifications to backbone
    Mutation D10A was introduced into the Cas9 sequence to generate a Cas9 nickase mutant.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HUWE1 sgRNA2
  • Alt name
    HUWE1 sgRNA2 "GCCGCGCGATCAACAGCCTC"
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • GenBank ID
    NM_031407.6
  • Entrez Gene
    HUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HUWE1-sgRNA-2 was a gift from Yihong Ye (Addgene plasmid # 86925 ; http://n2t.net/addgene:86925 ; RRID:Addgene_86925)
  • For your References section:

    The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Xu Y, Anderson DE, Ye Y. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016. 10.1038/celldisc.2016.40 PubMed 27867533