This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pENTR1A-Huwe1 C4341S
(Plasmid #37432)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37432 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR1A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2717
  • Total vector size (bp) 16560
  • Vector type
    Gateway Entry

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Huwe1
  • Alt name
    Mule
  • Alt name
    ARF-BP1
  • Alt name
    Lasu1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    13071
  • Mutation
    C4341S
  • Entrez Gene
    HUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MULE, URE-B1, UREB1)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer hHuwe1-R (GCCAAATGTTGTAGCCGAGT)
  • 3′ sequencing primer hHuwe1-F (TATCAGGACTGCCCACCATT)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Full-length cDNA constructed by sequential cloning of PCR products and adding to a partial cDNA.

The ORF sequence provided contains Q2315H and 3016del3031 amino acid mutations compared to closest reference sequence NP_113584.3).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR1A-Huwe1 C4341S was a gift from Jean Cook (Addgene plasmid # 37432 ; http://n2t.net/addgene:37432 ; RRID:Addgene_37432)