pTUB1:OsTIR1-3FLAG, SAG1:CAT
(Plasmid #87258)

• Purpose: TIR1-3FLAG fusion driven by a TUB1 promoter with a CAT drug selectable marker. The TIR1 CDS from Oryza sativa was codon optimized for T. gondii expression.
• Depositing Lab: David Sibley
• Depositing Organization: Washington University in Saint Louis
  Located in the United States of America
• Publication: Brown et al MBio. 2017 May 2;8(3). pii: e00375-17. doi: 10.1128/mBio.00375-17.
• Citations: 8 Articles

Backbone

• Vector backbone: pBluescript SK(+)
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 2925
• Total vector size (bp): 9655
• Vector type: Toxoplasma expression
• Selectable markers: CAT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: TIR1
• Species: Synthetic; Oryza sativa
• Insert Size (bp): 1806
• Mutation: Codon optimized for Toxoplasma gondii expression
• GenBank ID: 4335696
• Promoter: TgTUB1 2717 bp
• Tag / Fusion Protein:
  • 3FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cttgtgtgaagttcttgcgg
• 3′ sequencing primer: gataaaggacacaggggtct

Gene/Insert 2

• Gene/Insert name: CAT
• Alt name: Chloramphenicol acetyltransferase
• Alt name: CmR
• Species: Synthetic
• Insert Size (bp): 663
• Promoter: TgSAG1 361 bp

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: cggttgtatgtcggtttcgc
• 3′ sequencing primer: tgtgtattgacccatgtggc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 87258-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 87258-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.