PI(LM)-Rac1(WT)dc1.FLARE
(Plasmid #87590)

• Purpose: PI(LM): Photo-inhibitable/lit mutant I510E/I539E dc1.FLARE: built based on GTPase FLARE dual chain sensor
• Depositing Lab: Klaus Hahn
• Depositing Organization: University of North Carolina at Chapel Hill
  Located in the United States of America
• Publication: Dagliyan et al Science. 2016 Dec 16;354(6318):1441-1444.

Backbone

• Vector backbone: pTriEx
• Backbone size w/o insert (bp): 5238
• Total vector size (bp): 7228
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LOV2
• Species: Synthetic
• Insert Size (bp): 447
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: aagtatcgggccctttgtgc
• 3′ sequencing primer: GGCAGCCTGCACCTGAGGTTAATCAC

Gene/Insert 2

• Gene/Insert name: PBD
• Promoter: CMV
• Tag / Fusion Protein:
  • YPet

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: aagtatcgggccctttgtgc
• 3′ sequencing primer: GGCAGCCTGCACCTGAGGTTAATCAC

Gene/Insert 3

• Gene/Insert name: Rac1
• Promoter: CMV
• Tag / Fusion Protein:
  • dTurq

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: TCGATCTCAGTGGTATTTGTG
• 3′ sequencing primer: AAGTTCTTTTGCCGCCTCATC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene's quality control sequencing finds an additional T to I amino acid residue substitution in the LOV2 domain of this construct. The affect of this residue change is unknown.

DNA (Catalog # 87590-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 87590-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.