Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLL3.7m-psMEK1tight
(Plasmid #89362)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89362 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.7m
  • Backbone manufacturer
    Luk Parijs
  • Backbone size w/o insert (bp) 6500
  • Modifications to backbone
    5' and 3' UTRs of HIV transcript reduced while retaining essential packaging elements
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    psMEK1tight
  • Alt name
    photoswitchable MEK1tight
  • Alt name
    photoswitchable MAPKK1tight
  • Alt name
    photoswitchable MAP2K1tight
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • pdDronpa
    • Human influenza hemagglutinin (HA) tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer CGGCCTTTTTACGGTTCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7m-psMEK1tight was a gift from Michael Lin (Addgene plasmid # 89362 ; http://n2t.net/addgene:89362 ; RRID:Addgene_89362)
  • For your References section:

    Optical control of cell signaling by single-chain photoswitchable kinases. Zhou XX, Fan LZ, Li P, Shen K, Lin MZ. Science. 2017 Feb 24;355(6327):836-842. doi: 10.1126/science.aah3605. 10.1126/science.aah3605 PubMed 28232577