-
PurposeExpresses humanized AsCpf1 variant that recognizes TYCV PAMs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5402
- Total vector size (bp) 9509
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCpf1, RR variant
-
Alt nameAsCas12a, RR variant
-
SpeciesSynthetic; Acidaminococcus sp.
-
Insert Size (bp)4107
-
MutationS542R/K607R
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS-3xHA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This variant also recognizes CCCC and ACCC PAMs (and, with lower efficiency, VYCV).
For more information on Zhang lab CRISPR plasmids, please refer to www.addgene.org/crispr/zhang/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-hAsCpf1(TYCV) (pY210) was a gift from Feng Zhang (Addgene plasmid # 89351 ; http://n2t.net/addgene:89351 ; RRID:Addgene_89351) -
For your References section:
Engineered Cpf1 variants with altered PAM specificities. Gao L, Cox DBT, Yan WX, Manteiga JC, Schneider MW, Yamano T, Nishimasu H, Nureki O, Crosetto N, Zhang F. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. 10.1038/nbt.3900 PubMed 28581492